pCJ162
(Plasmid
#175055)
-
Purposelox66-72 flanked gentamycin resistance cassette integrates into aquI integration site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep15A
- Total vector size (bp) 4223
-
Vector typeUnspecified
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namelox66::gmR::lox71
-
Insert Size (bp)917
-
GenBank IDn/a
- Promoter n/a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taagacattcatcgcgcttg
- 3′ sequencing primer caagcgcgatgaatgtctta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCJ162 was a gift from David Nielsen (Addgene plasmid # 175055 ; http://n2t.net/addgene:175055 ; RRID:Addgene_175055) -
For your References section:
Exploiting Polyploidy for Markerless and Plasmid-Free Genome Engineering in Cyanobacteria. Jones CM, Parrish S, Nielsen DR. ACS Synth Biol. 2021 Sep 17;10(9):2371-2382. doi: 10.1021/acssynbio.1c00269. Epub 2021 Aug 17. 10.1021/acssynbio.1c00269 PubMed 34530614