pCJ155
(Plasmid
#175054)
-
PurposepsbEFLJ integrative plasmid expresses CRE recombinase from the rbcL promoter uses zeocin to integrate
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 5345
-
Vector typeUnspecified
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRE
-
Insert Size (bp)1029
- Promoter rbcLXS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tggcgaagataagctctggt
- 3′ sequencing primer gacacgacctccgaccac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCJ155 was a gift from David Nielsen (Addgene plasmid # 175054 ; http://n2t.net/addgene:175054 ; RRID:Addgene_175054) -
For your References section:
Exploiting Polyploidy for Markerless and Plasmid-Free Genome Engineering in Cyanobacteria. Jones CM, Parrish S, Nielsen DR. ACS Synth Biol. 2021 Sep 17;10(9):2371-2382. doi: 10.1021/acssynbio.1c00269. Epub 2021 Aug 17. 10.1021/acssynbio.1c00269 PubMed 34530614