Skip to main content
Addgene

Halo-WIPI2B H85E K88E I92E
(Plasmid #175033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175033 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHTN
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6143
  • Total vector size (bp) 7410
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    WIPI2B (H85E K88E I92E)
  • Species
    H. sapiens (human)
  • Mutation
    Histadine 85 to Glutamate (CAC to GAG); Lysine 88 to Glutamate (AAG to GAG); Isoleucine 92 to Glutamate (ATC to GAA)
  • Entrez Gene
    WIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
  • Promoter CMV
  • Tag / Fusion Protein
    • HaloTag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer cctgatcggcagcgagatcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Sharon Tooze, Francis Crick Institute, UK

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Halo-WIPI2B H85E K88E I92E was a gift from Andrea Stavoe (Addgene plasmid # 175033 ; http://n2t.net/addgene:175033 ; RRID:Addgene_175033)
  • For your References section:

    Structural basis for membrane recruitment of ATG16L1 by WIPI2 in autophagy. Strong LM, Chang C, Riley JF, Boecker CA, Flower TG, Buffalo CZ, Ren X, Stavoe AK, Holzbaur EL, Hurley JH. Elife. 2021 Sep 10;10. pii: 70372. doi: 10.7554/eLife.70372. 10.7554/eLife.70372 PubMed 34505572