Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

px459 sgAtg5
(Plasmid #175023)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175023 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    px459
  • Backbone size w/o insert (bp) 9174
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATG5
  • gRNA/shRNA sequence
    AAGATGTGCTTCGAGATGTG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_004849.4
  • Entrez Gene
    ATG5 (a.k.a. APG5, APG5-LIKE, APG5L, ASP, SCAR25, hAPG5)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6 FWD
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px459 sgAtg5 was a gift from David Tumbarello (Addgene plasmid # 175023 ; http://n2t.net/addgene:175023 ; RRID:Addgene_175023)
  • For your References section:

    Loss of the Essential Autophagy Regulators FIP200 or Atg5 Leads to Distinct Effects on Focal Adhesion Composition and Organization. Assar EA, Tumbarello DA. Front Cell Dev Biol. 2020 Aug 4;8:733. doi: 10.3389/fcell.2020.00733. eCollection 2020. 10.3389/fcell.2020.00733 PubMed 32850845