px459 sgAtg5
(Plasmid
#175023)
-
PurposeCRISPR-Cas9 plasmid targeting exon 2 of human Atg5.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx459
- Backbone size w/o insert (bp) 9174
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATG5
-
gRNA/shRNA sequenceAAGATGTGCTTCGAGATGTG
-
SpeciesH. sapiens (human)
-
GenBank IDNM_004849.4
-
Entrez GeneATG5 (a.k.a. APG5, APG5-LIKE, APG5L, ASP, SCAR25, hAPG5)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6 FWD (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px459 sgAtg5 was a gift from David Tumbarello (Addgene plasmid # 175023 ; http://n2t.net/addgene:175023 ; RRID:Addgene_175023) -
For your References section:
Loss of the Essential Autophagy Regulators FIP200 or Atg5 Leads to Distinct Effects on Focal Adhesion Composition and Organization. Assar EA, Tumbarello DA. Front Cell Dev Biol. 2020 Aug 4;8:733. doi: 10.3389/fcell.2020.00733. eCollection 2020. 10.3389/fcell.2020.00733 PubMed 32850845