Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLentiCRISPRv2 sgSp1
(Plasmid #174907)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174907 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 14873
  • Total vector size (bp) 13013
  • Modifications to backbone
    Flag tag on Cas9 deleted
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Specificity Protein 1
  • gRNA/shRNA sequence
    CACCGCATGGATGAAATGACAGCTG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4123
  • Mutation
    Missense mutation to mutate PAM sequence
  • GenBank ID
    NM_138473.2
  • Entrez Gene
    SP1
  • Promoter EFS-NS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer hEF1aprom-F
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2 sgSp1 was a gift from Jane Clifford (Addgene plasmid # 174907 ; http://n2t.net/addgene:174907 ; RRID:Addgene_174907)
  • For your References section:

    DSB repair pathway choice is regulated by recruitment of 53BP1 through cell cycle-dependent regulation of Sp1. Swift ML, Beishline K, Flashner S, Azizkhan-Clifford J. Cell Rep. 2021 Mar 16;34(11):108840. doi: 10.1016/j.celrep.2021.108840. 10.1016/j.celrep.2021.108840 PubMed 33730584