pLentiCRISPRv2 sgSp1
(Plasmid
#174907)
-
PurposeSecond generation sgRNA against Sp1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPRv2
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 14873
- Total vector size (bp) 13013
-
Modifications to backboneFlag tag on Cas9 deleted
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpecificity Protein 1
-
gRNA/shRNA sequenceCACCGCATGGATGAAATGACAGCTG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4123
-
MutationMissense mutation to mutate PAM sequence
-
GenBank IDNM_138473.2
-
Entrez GeneSP1
- Promoter EFS-NS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer hEF1aprom-F
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2 sgSp1 was a gift from Jane Clifford (Addgene plasmid # 174907 ; http://n2t.net/addgene:174907 ; RRID:Addgene_174907) -
For your References section:
DSB repair pathway choice is regulated by recruitment of 53BP1 through cell cycle-dependent regulation of Sp1. Swift ML, Beishline K, Flashner S, Azizkhan-Clifford J. Cell Rep. 2021 Mar 16;34(11):108840. doi: 10.1016/j.celrep.2021.108840. 10.1016/j.celrep.2021.108840 PubMed 33730584