HP-Cas9hGem-Ade2-LEU2-LINEAR
(Plasmid #174839)

• Purpose: pRS414 backbone containing LINEAR fragment targeting ADE2 in H. polymorpha
• Depositing Lab: Zengyi Shao
• Publication: Ploessl et al Nat Chem Biol. 2021 Oct 28. pii: 10.1038/s41589-021-00893-5. doi: 10.1038/s41589-021-00893-5.

Backbone

• Vector backbone: pRS414
• Total vector size (bp): 13049
• Vector type: Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology
• Selectable markers: TRP1, LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
• Species: Ogataea (para)polymorpha
• Insert Size (bp): 215
• GenBank ID: XM_014078618
• Promoter: TDH3p

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GAACAGGGGCACAAACAGGC

Resource Information

• Supplemental Documents:
  • HP-CashGem-Ade2-LEU2-LINEAR
• A portion of this plasmid was derived from a plasmid made by: A portion of this plasmid was derived from pUDP013 (Addgene #103873)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry