pLenti X2 Neo/pTER shEGFP#2 (w22-2)
(Plasmid #17480)

• Purpose: 3rd gen lentiviral eGFP shRNA #2 (H1/TO promoter), 3’LTR insertion, Neo 
• Depositing Labs: Eric Campeau, Paul Kaufman
• Publication: Campeau et al PLoS One. 2009 Aug 6;4(8):e6529.

Backbone

• Vector backbone: p156RRL-sinPPT-CMV-GFP-PRE/Nhe I
• Backbone size w/o insert (bp): 7919
• Vector type: Lentiviral, RNAi
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl3, 37OC
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Enhanced green fluorescent protein shRNA #2
• Alt name: shGFP #2
• gRNA/shRNA sequence: CCGCTGGAGTACAACTACAACTTCAAGAGAGTTGTAGTTGTACTCCAGCTTTTT
• Insert Size (bp): 66

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bgl II (destroyed during cloning)
• 3′ cloning site: Hind III (not destroyed)
• 5′ sequencing primer: n/a

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the full plasmid sequence may be assembled and not fully confirmed. Minor mismatches should not affect plasmid function.