Skip to main content
Addgene

pDTCendoNA2
(Plasmid #174732)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174732 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFEndoNA2
  • Backbone manufacturer
    Finne lab
  • Backbone size w/o insert (bp) 7102
  • Total vector size (bp) 7546
  • Modifications to backbone
    The egfp gene deleted, and NotI and SpeI restriction sites introduced
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DT386C
  • Alt name
    tox gene
  • Species
    Corynebacterium diphtheriae
  • Insert Size (bp)
    1181
  • Mutation
    Deleted amino acids 412-560 (the receptor binding domain R of diphtheria toxin) and added the caspase-3/7 cleavage motif DEVD.
  • GenBank ID
    NC_002935.2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer CCCGAAAAGTGCCACCTG
  • 3′ sequencing primer CGTGTACAGCTTATCTAACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDTCendoNA2 was a gift from Jukka Finne (Addgene plasmid # 174732 ; http://n2t.net/addgene:174732 ; RRID:Addgene_174732)
  • For your References section:

    Design of a cytotoxic neuroblastoma-targeting agent using an enzyme acting on polysialic acid fused to a toxin. Lehti TA, Pajunen MI, Jokilammi A, Korja M, Lilie H, Vettenranta K, Finne J. Mol Cancer Ther. 2021 Jul 26. pii: 1535-7163.MCT-20-1031. doi: 10.1158/1535-7163.MCT-20-1031. 10.1158/1535-7163.MCT-20-1031 PubMed 34315766