pDTFendoNA2
(Plasmid #174731)

• Purpose: Expresses DT386F-endoNA2 fusion protein for selective elimination of polysialic acid–containing cells. Truncated diphtheria toxin fused to noncatalytic endosialidase via a furin-cleavable linker.
• Depositing Lab: Jukka Finne
• Publication: Lehti et al Mol Cancer Ther. 2021 Jul 26. pii: 1535-7163.MCT-20-1031. doi: 10.1158/1535-7163.MCT-20-1031.

Backbone

• Vector backbone: pFEndoNA2
• Backbone manufacturer: Finne lab
• Backbone size w/o insert (bp): 7102
• Total vector size (bp): 7546
• Modifications to backbone: The egfp gene deleted, and NotI and SpeI restriction sites introduced
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DT386F
• Alt name: tox gene
• Species: Corynebacterium diphtheriae
• Insert Size (bp): 1181
• Mutation: Deleted amino acids 412-560 (the receptor binding domain R of diphtheria toxin) and added the furin protease cleavage motif RVRR.
• GenBank ID: NC_002935.2

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: CCCGAAAAGTGCCACCTG
• 3′ sequencing primer: CGTGTACAGCTTATCTAACC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).