pDRM210 LGP (Luciferase GFP Puro)
(Plasmid #174722)

• Purpose: Expresses the firefly luciferase gene, E2A, eGFP, F2A, and the puromycin resistance gene
• Depositing Lab: Wayne Tilley
• Publication: Mustafa et al Oncogene. 2023 Nov 24. doi: 10.1038/s41388-023-02892-3.

Backbone

• Vector backbone: pRRLSIN.cPPT.MND
• Backbone size w/o insert (bp): 6685
• Total vector size (bp): 9863
• Vector type: Mammalian Expression, Lentiviral, Luciferase
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Firefly Luciferase
• Alt name: Luc
• Species: Photinus pyralis
• Insert Size (bp): 1650
• Promoter: MND
• Tag / Fusion Protein:
  • E2A linker (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: MND-F (GTTCGCTTCTCGCTTCTGTT)

Gene/Insert 2

• Gene/Insert name: eGFP
• Alt name: Enhanced Green Fluorescent Protein
• Species: Aequorea victoria
• Insert Size (bp): 717
• Promoter: MND (off Luc-E2A)
• Tag / Fusion Protein:
  • F2A linker (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: Luc-F (GACGAAGTACCGAAAGGTCTT)

Gene/Insert 3

• Gene/Insert name: pac
• Alt name: puromycin acetyl transferase/ PuroR
• Species: Streptomyces alboniger
• Insert Size (bp): 600
• Promoter: MND (off Luc-E2A-eGFP-F2A)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: WPRE-R (GCGTAAAAGGAGCAACATAG)

Resource Information

• Supplemental Documents:
  • pDRM210 LGP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry