Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDRM18 LTN (Luciferase tdTomato Neo)
(Plasmid #174721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRRLSIN.cPPT.MND
  • Backbone size w/o insert (bp) 6685
  • Total vector size (bp) 10731
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Firefly Luciferase
  • Alt name
    Luc
  • Species
    Photinus pyralis
  • Insert Size (bp)
    1650
  • Promoter MND
  • Tag / Fusion Protein
    • E2A linker (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    tdTomato
  • Alt name
    Tomato
  • Species
    Synthetic
  • Insert Size (bp)
    1428
  • Promoter MND (off Luc-E2A)
  • Tag / Fusion Protein
    • P2A linker (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer Use Luc-F (GACGAAGTACCGAAAGGTCTT), Neo-R (GTCATAGCCGAATAGCCTCTC), and/or tdTomato Internal-R (TCTTTGATGACGGCCATGT)
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    aph
  • Alt name
    Aminoglycoside phosphotransferase/NeoR/KanR
  • Species
    Escherichia coli
  • Insert Size (bp)
    792
  • GenBank ID
  • Promoter MND (off Luc-E2A-tdTomato-P2A)

Cloning Information for Gene/Insert 3

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDRM18 LTN (Luciferase tdTomato Neo) was a gift from Wayne Tilley (Addgene plasmid # 174721 ; http://n2t.net/addgene:174721 ; RRID:Addgene_174721)
  • For your References section:

    Selective inhibition of CDK9 in triple negative breast cancer. Mustafa EH, Laven-Law G, Kikhtyak Z, Nguyen V, Ali S, Pace AA, Iggo R, Kebede A, Noll B, Wang S, Winter JM, Dwyer AR, Tilley WD, Hickey TE. Oncogene. 2023 Nov 24. doi: 10.1038/s41388-023-02892-3. 10.1038/s41388-023-02892-3 PubMed 38001268