pDRM18 LTN (Luciferase tdTomato Neo)
(Plasmid #174721)

• Purpose: Expresses the firefly luciferase gene, E2A, tdTomato, P2A, and the neomycin resistance gene.
• Depositing Lab: Wayne Tilley
• Publication: Mustafa et al Oncogene. 2023 Nov 24. doi: 10.1038/s41388-023-02892-3.

Backbone

• Vector backbone: pRRLSIN.cPPT.MND
• Backbone size w/o insert (bp): 6685
• Total vector size (bp): 10731
• Vector type: Mammalian Expression, Lentiviral, Luciferase
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Firefly Luciferase
• Alt name: Luc
• Species: Photinus pyralis
• Insert Size (bp): 1650
• Promoter: MND
• Tag / Fusion Protein:
  • E2A linker (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: MND-F (GTTCGCTTCTCGCTTCTGTT)

Gene/Insert 2

• Gene/Insert name: tdTomato
• Alt name: Tomato
• Species: Synthetic
• Insert Size (bp): 1428
• Promoter: MND (off Luc-E2A)
• Tag / Fusion Protein:
  • P2A linker (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: Use Luc-F (GACGAAGTACCGAAAGGTCTT), Neo-R (GTCATAGCCGAATAGCCTCTC), and/or tdTomato Internal-R (TCTTTGATGACGGCCATGT)

Gene/Insert 3

• Gene/Insert name: aph
• Alt name: Aminoglycoside phosphotransferase/NeoR/KanR
• Species: Escherichia coli
• Insert Size (bp): 792
• GenBank ID:
• Promoter: MND (off Luc-E2A-tdTomato-P2A)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: WPRE-R (GCGTAAAAGGAGCAACATAG)

Resource Information

• Supplemental Documents:
  • pDRM18 LTN.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry