pDRM98 mKate2 Blast
(Plasmid #174720)

• Purpose: Expresses the NLS-tagged mKate2 gene, P2A and the blasticidin resistance gene.
• Depositing Lab: Wayne Tilley
• Publication: Mustafa et al Oncogene. 2023 Nov 24. doi: 10.1038/s41388-023-02892-3.

Backbone

• Vector backbone: pRRLSIN.cPPT.MND
• Backbone size w/o insert (bp): 6685
• Total vector size (bp): 7087
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mKate2
• Species: Synthetic
• Insert Size (bp): 693
• Promoter: MND
• Tags / Fusion Proteins:
  • SV40 NLS with GGS linker (N terminal on backbone)
  • P2A linker (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: MND-F (GTTCGCTTCTCGCTTCTGTT)

Gene/Insert 2

• Gene/Insert name: BSD
• Alt name: Blasticidin-S deaminase/BlastR
• Species: Aspergillus terreus
• Insert Size (bp): 393
• GenBank ID:
• Promoter: MND (off mKate-P2A)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: WPRE-R (GCGTAAAAGGAGCAACATAG)

Resource Information

• Supplemental Documents:
  • pDRM98 mKate.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry