pENTR/pTER shEGFP #2 (728-2)
(Plasmid
#17471)
-
PurposeGateway entry vector for EGFPshRNA#2 under H1/TO promoter
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR1A
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2556
-
Vector typeRNAi ; Entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsTOP10F', 37oC
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEnhanced green fluorescent protein shRNA #2
-
Alt nameGFP shRNA #2
-
Insert Size (bp)66
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (destroyed during cloning)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer ENTRforw
- 3′ sequencing primer ENTRrev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA sequence is- 5'-CCGCTGGAGTACAACTACAACTTCAAGAGAGTTGTAGTTGTACTCCAGCTTTTT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR/pTER shEGFP #2 (728-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17471 ; http://n2t.net/addgene:17471 ; RRID:Addgene_17471) -
For your References section:
A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394