pFB_ROSA26_SpCas9_gRNAs
(Plasmid
#174703)
-
PurposePlasmid containing separate SpCas9 gRNAs for targeted excision of inserted STOP Cassette upstream of reporter alleles found in Ai14 and Ai6 mice. ITRs flank the cassette for easy vector creation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFB
- Backbone size w/o insert (bp) 4587
- Total vector size (bp) 5814
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSpCas9 dual gRNAs
-
gRNA/shRNA sequencegRNA upstream 1: 5’ GTATGCTATACGAAGTTATT 3’, gRNA downstream 2: 5’ AAAGAATTGATTTGATACCG 3’
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CCTAGGACTAGAGAGAGGGC
- 3′ sequencing primer AAGACACACAACCAAAAAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB_ROSA26_SpCas9_gRNAs was a gift from Beverly L. Davidson (Addgene plasmid # 174703 ; http://n2t.net/addgene:174703 ; RRID:Addgene_174703) -
For your References section:
Standard screening methods underreport AAV-mediated transduction and gene editing. Lang JF, Toulmin SA, Brida KL, Eisenlohr LC, Davidson BL. Nat Commun. 2019 Jul 30;10(1):3415. doi: 10.1038/s41467-019-11321-7. 10.1038/s41467-019-11321-7 PubMed 31363095