pLV[Expression]-mCherry:T2A:Hygro-EF1A>Luc2
(Plasmid #174665)

• Purpose: Expresses humanized firefly luciferase and mCherry and Hygromycin resistance linked by T2A, each controlled by a strong promoter
• Depositing Lab: Eli Bar
• Publication: pLV[Expression]-mCherry:T2A:Hygro-EF1A>Luc2 (unpublished)

Backbone

• Vector backbone: pLV
• Backbone manufacturer: VectorBuilder
• Vector type: Mammalian Expression, Lentiviral, Luciferase
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: LUC2
• Alt name: Human codon optimized to reduce cryptic transcription factor binding sites
• Species: Synthetic; Photinus pyralis
• Insert Size (bp): 1653
• Promoter: Human eukaryotic translation elongation factor 1 α1 promoter

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Gene/Insert 2

• Gene/Insert name: mCherry:T2A:Hygro
• Species: Discosoma sp.
• Insert Size (bp): 1797
• Promoter: Human cytomegalovirus immediate early enhancer/promoter
• Tag / Fusion Protein:
  • mCherry and hygromycin dual reporter gene linked by T2A

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CCATTTCAGGTGTCGTGA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry