pCW17 - pAdapter
(Plasmid
#174664)
-
PurposeConstitutive expression of λCI fused via three alanines to the MS2 coat protein. Useful as RNA-DNA adapter in three-hybrid system.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174664 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepACYC184
- Total vector size (bp) 3535
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMS2 coat protein
-
Alt nameMS2cp
-
SpeciesBacteriophage MS2
-
Insert Size (bp)378
-
MutationV30I, A81G, positions 68-80 deleted (VATQTVGGVELPV), cloned behind a EFPGIHPGM linker
- Promoter Synthetic Constitutive Promoter
-
Tag
/ Fusion Protein
- λCI
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGACCAAAACGATCTCAAGAAGATCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW17 - pAdapter was a gift from Katherine Berry (Addgene plasmid # 174664 ; http://n2t.net/addgene:174664 ; RRID:Addgene_174664) -
For your References section:
Genetic identification of the functional surface for RNA binding by Escherichia coli ProQ. Pandey S, Gravel CM, Stockert OM, Wang CD, Hegner CL, LeBlanc H, Berry KE. Nucleic Acids Res. 2020 May 7;48(8):4507-4520. doi: 10.1093/nar/gkaa144. 10.1093/nar/gkaa144 PubMed 32170306
