pKB817 (pBra-Hfq)
(Plasmid #174661)

• Purpose: Plpp/PlacUV5- directed synthesis of the alpha NTD fused to E. coli Hfq. Useful as three-hybrid positive control.
• Depositing Labs: Katherine Berry, Ann Hochschild
• Publication: Berry et al Nucleic Acids Res. 2018 Jan 25;46(2):e12. doi: 10.1093/nar/gkx1086.

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 5100
• Total vector size (bp): 5402
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB5alpha F'LacIQ
• Growth instructions: We recommend using a lacIQ strain, such as NEB5alpha F'LacIQ, in order to ensure that the expression of potentially toxic fusion proteins is kept repressed.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Hfq
• Species: E. coli
• Insert Size (bp): 303
• Promoter: lpp/lacUV5 (tandem promoter)
• Tag / Fusion Protein:
  • alpha NTD

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GAACAGCGTACCGACCTGG
• 3′ sequencing primer: GGTGATGTCGGCGATATAGG

Resource Information

• Supplemental Documents:
  • pKB817_pBR_a_EcHfq.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry