PB-PE NG
(Plasmid #174554)

• Purpose: All-in-one prime editor piggyBac transposon, NG variant
• Depositing Lab: Tobias Cantz
• Publication: Eggenschwiler et al Sci Rep. 2021 Nov 12;11(1):22154. doi: 10.1038/s41598-021-01689-2.

Backbone

• Vector backbone: pEX-A2
• Backbone manufacturer: Eurofins Genomics
• Backbone size w/o insert (bp): 5120
• Total vector size (bp): 13136
• Modifications to backbone: addition of 3' and 5' piggyBac repeats, addition of pU6-pegRNA(B12B) sequence, addition of CAG promoter, addition of bGH (pA)
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology ; piggyBac transposon
• Selectable markers: Puromycin ; thymidine kinase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: It is highly recommended to use NEB Stable at 30°C. Cloning efficiency and stability of plasmid can be compromised when using other strains / higher temperatures!
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SpCas9 NG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
• Species: Synthetic
• Insert Size (bp): 8016
• Mutation: L1111R, G1218R, E1219F, A1322R, R1335V, T1337R
• Promoter: CAG
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • SV40 NLS (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AAGAATTGATAGCGGCCGCTAA

Resource Information

• Supplemental Documents:
  • PB-PE NG.gbk
• A portion of this plasmid was derived from a plasmid made by: Cas9 NG was PCR amplified from pX330-SpCas9-NG (Addgene #117919)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry