AAV sgRNA Expression Plasmid
(Plasmid #174540)

• Purpose: (Empty Backbone) Contains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.
• Depositing Lab: Ormond MacDougald
• Publication: Romanelli et al J Biol Chem. 2021 Nov 11:101402. doi: 10.1016/j.jbc.2021.101402.

Backbone

• Vector backbone: pCWB
• Backbone size (bp): 5067
• Vector type: Mammalian Expression, AAV
• Promoter: CMV
• Selectable markers: mCherry
• Tag / Fusion Protein:
  • None (N terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: tttcccatgattccttcata
• 3′ sequencing primer: GGGCGGGGGTCGTTGGGCGG

Resource Information

• Supplemental Documents:
  • sgRNA Cloning Protocol
• A portion of this plasmid was derived from a plasmid made by: University of Michigan Vector Core

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The original pCWB-CMV mCherry plasmid was provided by the University of Michigan Vector Core. We inserted a cloning site into the original plasmid that would enable the cloning of a U6 promoter-driven sgRNA into the backbone.