pBAD_sfGFP3TCG4TAG
(Plasmid #174518)

• Purpose: Recoded sfGFP reporter with the codons TCG and TAG inserted at positions 3 and 4, respectively.
• Depositing Lab: Jason W Chin
• Publication: Robertson et al Science. 2021 Jun 4;372(6546):1057-1062. doi: 10.1126/science.abg3029.

Backbone

• Vector backbone: pBAD
• Backbone size w/o insert (bp): 3896
• Total vector size (bp): 4646
• Modifications to backbone: The entire backbone was recoded according to the genome of Syn61. AmpR gene was replaced by ApmR (Apramycin)
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sfGFP
• Insert Size (bp): 750
• Mutation: Recoded. TCG and TAG codons were introduced in positions 3 and 4
• Promoter: araBAD
• Tag / Fusion Protein:
  • 6 x His (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Resource Information

• Supplemental Documents:
  • pBAD_sfGFP3TCG4TAG.gb
• A portion of this plasmid was derived from a plasmid made by: The original sfGFP sequence was published in: Pédelacq JD, Cabantous S, Tran T, Terwilliger TC, Waldo GS. Engineering and characterization of a superfolder green fluorescent protein. Nat Biotechnol. 2006;24:79-88.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry