Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

opto-Itsn1
(Plasmid #174509)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174509 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5341
  • Total vector size (bp) 8944
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    opto-Itsn1-mCherry
  • Species
    H. sapiens (human); Botrytis cinerea
  • Insert Size (bp)
    3603
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    opto-Itsn1 was a gift from Brian Chow (Addgene plasmid # 174509 ; http://n2t.net/addgene:174509 ; RRID:Addgene_174509)
  • For your References section:

    Designing Single-Component Optogenetic Membrane Recruitment Systems: The Rho-Family GTPase Signaling Toolbox. Berlew EE, Yamada K, Kuznetsov IA, Rand EA, Ochs CC, Jaber Z, Gardner KH, Chow BY. ACS Synth Biol. 2022 Jan 21;11(1):515-521. doi: 10.1021/acssynbio.1c00604. Epub 2022 Jan 3. 10.1021/acssynbio.1c00604 PubMed 34978789