pKan cpRBP-FL P53
(Plasmid
#174504)
-
PurposeExpress Full-length P53 in E.coli with cleavable expression/purification tag (ribose binding protein circular permutant)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET41
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5933
- Total vector size (bp) 7225
-
Modifications to backboneThe synthetic gene of Thermoanaerobacter tencongenesis ribose binding protein (tteRBP) circular permutant with N-terminal HisTag is inserted between NdeI and XhoI sites. The original N- and C-termini of tteRBP are linked with 58 amino acid linker containing two HRV3C protease sites.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameP53 gene
-
Alt nameTP53
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1185
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
- Promoter T7
-
Tags
/ Fusion Proteins
- tteRBP circular permutant (97 - 277 amino acids) with N-terminal histag and 27amino acid linker containing HRV3C protease site (N terminal on backbone)
- 20 amino acid linker containing HRV3C protease site followed by tteRBP circular permutant (1 -96 amino acid) (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCCTAATTTTATCCCCGCTG
- 3′ sequencing primer GGTACTGATGACCAGACCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original P53 gene sequence was obtained the plasmid, PHP53B (purchased from ATCC).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKan cpRBP-FL P53 was a gift from Stewart Loh (Addgene plasmid # 174504 ; http://n2t.net/addgene:174504 ; RRID:Addgene_174504) -
For your References section:
Urea Denaturation, Zinc Binding, and DNA Binding Assays of Mutant p53 DNA-binding Domains and Full-length Proteins. Ha JH, Yu X, Carpizo DR, Loh SN. Bio Protoc. 2021 Oct 20;11(20):e4188. doi: 10.21769/BioProtoc.4188. eCollection 2021 Oct 20. 10.21769/BioProtoc.4188 PubMed 34786438