pKan cpRBP-FL P53
(Plasmid #174504)

• Purpose: Express Full-length P53 in E.coli with cleavable expression/purification tag (ribose binding protein circular permutant)
• Depositing Lab: Stewart Loh
• Publication: Ha et al Bio Protoc. 2021 Oct 20;11(20):e4188. doi: 10.21769/BioProtoc.4188. eCollection 2021 Oct 20.

Backbone

• Vector backbone: pET41
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5933
• Total vector size (bp): 7225
• Modifications to backbone: The synthetic gene of Thermoanaerobacter tencongenesis ribose binding protein (tteRBP) circular permutant with N-terminal HisTag is inserted between NdeI and XhoI sites. The original N- and C-termini of tteRBP are linked with 58 amino acid linker containing two HRV3C protease sites.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: P53 gene
• Alt name: TP53
• Species: H. sapiens (human)
• Insert Size (bp): 1185
• Entrez Gene: TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
• Promoter: T7
• Tags / Fusion Proteins:
  • tteRBP circular permutant (97 - 277 amino acids) with N-terminal histag and 27amino acid linker containing HRV3C protease site (N terminal on backbone)
  • 20 amino acid linker containing HRV3C protease site followed by tteRBP circular permutant (1 -96 amino acid) (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CCCTAATTTTATCCCCGCTG
• 3′ sequencing primer: GGTACTGATGACCAGACCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original P53 gene sequence was obtained the plasmid, PHP53B (purchased from ATCC).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry