Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTF023_His_hsDDA1
(Plasmid #174480)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174480 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAC8
  • Backbone size w/o insert (bp) 6785
  • Total vector size (bp) 7078
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DDA1
  • Alt name
    DET1 and DDB1associated protein 1
  • Alt name
    C19orf58
  • Alt name
    PCIA1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    306
  • Tag / Fusion Protein
    • His-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ACCATCTCGCAAATAAATAA
  • 3′ sequencing primer ACAACGCACAGAATCTAGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTF023_His_hsDDA1 was a gift from Eric Fischer (Addgene plasmid # 174480 ; http://n2t.net/addgene:174480 ; RRID:Addgene_174480)
  • For your References section:

    Structural complementarity facilitates E7820-mediated degradation of RBM39 by DCAF15. Faust TB, Yoon H, Nowak RP, Donovan KA, Li Z, Cai Q, Eleuteri NA, Zhang T, Gray NS, Fischer ES. Nat Chem Biol. 2020 Jan;16(1):7-14. doi: 10.1038/s41589-019-0378-3. Epub 2019 Nov 4. 10.1038/s41589-019-0378-3 PubMed 31686031