pHY002_Strep_Avi_hsDCAF15
(Plasmid
#174479)
-
PurposeExpresses DCAF15 in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174479 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAC8
- Backbone size w/o insert (bp) 6845
- Total vector size (bp) 8632
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDCAF 15
-
Alt nameDDB1- and CUL4-associated factor 15
-
Alt nameC19orf72
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1800
-
Entrez GeneDCAF15 (a.k.a. C19orf72)
-
Tag
/ Fusion Protein
- StrepII-Avi-TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer ACCATCTCGCAAATAAATAA
- 3′ sequencing primer ACAACGCACAGAATCTAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHY002_Strep_Avi_hsDCAF15 was a gift from Eric Fischer (Addgene plasmid # 174479 ; http://n2t.net/addgene:174479 ; RRID:Addgene_174479) -
For your References section:
Structural complementarity facilitates E7820-mediated degradation of RBM39 by DCAF15. Faust TB, Yoon H, Nowak RP, Donovan KA, Li Z, Cai Q, Eleuteri NA, Zhang T, Gray NS, Fischer ES. Nat Chem Biol. 2020 Jan;16(1):7-14. doi: 10.1038/s41589-019-0378-3. Epub 2019 Nov 4. 10.1038/s41589-019-0378-3 PubMed 31686031