Skip to main content
Addgene

pHY002_Strep_Avi_hsDCAF15
(Plasmid #174479)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174479 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAC8
  • Backbone size w/o insert (bp) 6845
  • Total vector size (bp) 8632
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DCAF 15
  • Alt name
    DDB1- and CUL4-associated factor 15
  • Alt name
    C19orf72
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1800
  • Entrez Gene
    DCAF15 (a.k.a. C19orf72)
  • Tag / Fusion Protein
    • StrepII-Avi-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer ACCATCTCGCAAATAAATAA
  • 3′ sequencing primer ACAACGCACAGAATCTAGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHY002_Strep_Avi_hsDCAF15 was a gift from Eric Fischer (Addgene plasmid # 174479 ; http://n2t.net/addgene:174479 ; RRID:Addgene_174479)
  • For your References section:

    Structural complementarity facilitates E7820-mediated degradation of RBM39 by DCAF15. Faust TB, Yoon H, Nowak RP, Donovan KA, Li Z, Cai Q, Eleuteri NA, Zhang T, Gray NS, Fischer ES. Nat Chem Biol. 2020 Jan;16(1):7-14. doi: 10.1038/s41589-019-0378-3. Epub 2019 Nov 4. 10.1038/s41589-019-0378-3 PubMed 31686031