-
Purpose3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Lentiviral Prep | 17446-LV | Virus (1mL at titer ≥ 5x10⁶ TU/mL) and Plasmid. | $180 | ||
Concentrated Lentiviral Prep | 17446-LVC | Viral service discontinued. | $205 |
Backbone
-
Vector backbonep156RRL-sinPPT-CMV-GFP-PRE/Nhe I
- Backbone size w/o insert (bp) 8591
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3, 37oC
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Alt nameenhanced GFP
-
Insert Size (bp)719
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer CMVforw (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for Lentiviral Prep (Catalog # 17446-LV) ( Back to top)
Purpose
Ready-to-use Lentiviral Prep particles produced from pLenti CMV GFP Hygro (656-4) (#17446). In addition to the viral particles, you will also receive purified pLenti CMV GFP Hygro (656-4) plasmid DNA.
Lentiviral particles carrying the GFP and hygromycin resistance.Delivery
- Volume 1mL
- Titer ≥5x10⁶ TU/mL
- Pricing $150 USD for preparation of 1mL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- ddPCR assay: 293T cells were transduced with serial dilutions of 17446-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
- PCR confirmation of insert: PCR was carried out with primers targeting the hygromycin resistance gene and the SV40 polyA. The PCR product was visualized on an agarose gel for size confirmation.
Forward Primer: Hygro-internal-F GCGCCGATGGTTTCTACAAA
Reverse Primer: SV40pA-R GAAATTTGTGATGCTATTGC
Visit our viral production page for more information.
Information for Concentrated Lentiviral Prep (Catalog # 17446-LVC) ( Back to top)
Addgene no longer distributes this item. Contact [email protected] for more information.
Viral service discontinued.
Purpose
Ready-to-use Concentrated Lentiviral Prep particles produced from pLenti CMV GFP Hygro (656-4) (#17446). In addition to the viral particles, you will also receive purified pLenti CMV GFP Hygro (656-4) plasmid DNA.
Concentrated lentiviral particles carrying the GFP and hygromcyin resistance.Delivery
- Volume .
- Titer ≥1×10⁷ TU/mL
- Pricing $175 USD for preparation of . virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids psPAX2 (plasmid #12260)
- Envelope pMD2.G (plasmid #12259)
- Buffer Opti-Pro SFM
- Selectable Marker Hygromycin
- Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- ddPCR assay: 293T cells were transduced with serial dilutions of 17446-LVC, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
- PCR confirmation of insert: PCR was carried out with primers targeting the hygromycin resistance gene and the SV40 polyA. The PCR product was visualized on an agarose gel for size confirmation.
Forward Primer: Hygro-internal-F GCGCCGATGGTTTCTACAAA
Reverse Primer: SV40pA-R GAAATTTGTGATGCTATTGC
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446 ; http://n2t.net/addgene:17446 ; RRID:Addgene_17446) For viral preps, please replace (Addgene plasmid # 17446) in the above sentence with: (Addgene viral prep # 17446-LV) or (Addgene viral prep # 17446-LVC) -
For your References section:
A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD.. PLoS One. 2009 Aug 6;4(8):e6529. 10.1371/journal.pone.0006529 PubMed 19657394