Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCE41
(Plasmid #174433)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174433 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2242
  • Total vector size (bp) 4307
  • Vector type
    Bacterial Expression, Yeast Expression, CRISPR
  • Selectable markers
    Hygromycin ; (HYG)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HYG 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
  • Species
    Candida auris
  • Insert Size (bp)
    2070
  • GenBank ID

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cacatttccccgaaaagtg
  • 3′ sequencing primer CTCACTGCCCGCTTTCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCE41 was a gift from Clarissa Nobile (Addgene plasmid # 174433 ; http://n2t.net/addgene:174433 ; RRID:Addgene_174433)
  • For your References section:

    A Markerless CRISPR-Mediated System for Genome Editing in Candida auris Reveals a Conserved Role for Cas5 in the Caspofungin Response. Ennis CL, Hernday AD, Nobile CJ. Microbiol Spectr. 2021 Dec 22;9(3):e0182021. doi: 10.1128/Spectrum.01820-21. Epub 2021 Nov 3. 10.1128/Spectrum.01820-21 PubMed 34730409