pCE38
(Plasmid #174432)

• Purpose: C. auris LEUpOUT HYG marker CAS9 expression construct. Use with pCE41 gRNA expression construct.
• Depositing Lab: Clarissa Nobile
• Publication: Ennis et al Microbiol Spectr. 2021 Dec 22;9(3):e0182021. doi: 10.1128/Spectrum.01820-21. Epub 2021 Nov 3.

Backbone

• Vector backbone: pUC19
• Backbone size w/o insert (bp): 2236
• Total vector size (bp): 9128
• Vector type: Bacterial Expression, CRISPR
• Selectable markers: Hygromycin ; (HYG)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C. auris LEU2 1 of 2, pENO1, Cas9, HYG 1 of 2
• Species: Candida auris
• Insert Size (bp): 6882

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cacatttccccgaaaagtg
• 3′ sequencing primer: CTCACTGCCCGCTTTCCAGT

Resource Information

• Supplemental Documents:
  • pCE38.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry