Skip to main content
Addgene

pCE38
(Plasmid #174432)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174432 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2236
  • Total vector size (bp) 9128
  • Vector type
    Bacterial Expression, CRISPR
  • Selectable markers
    Hygromycin ; (HYG)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    C. auris LEU2 1 of 2, pENO1, Cas9, HYG 1 of 2
  • Species
    Candida auris
  • Insert Size (bp)
    6882

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cacatttccccgaaaagtg
  • 3′ sequencing primer CTCACTGCCCGCTTTCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCE38 was a gift from Clarissa Nobile (Addgene plasmid # 174432 ; http://n2t.net/addgene:174432 ; RRID:Addgene_174432)
  • For your References section:

    A Markerless CRISPR-Mediated System for Genome Editing in Candida auris Reveals a Conserved Role for Cas5 in the Caspofungin Response. Ennis CL, Hernday AD, Nobile CJ. Microbiol Spectr. 2021 Dec 22;9(3):e0182021. doi: 10.1128/Spectrum.01820-21. Epub 2021 Nov 3. 10.1128/Spectrum.01820-21 PubMed 34730409