Skip to main content
Addgene

pAd5-Blue
(Plasmid #174431)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174431 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAd5-Blue
  • Backbone size w/o insert (bp) 35555
  • Total vector size (bp) 37236
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    best if grown in Terrific Broth best if plasmid is electroporated in DH5a/XL-1Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    β-galactosidase α gene fragment
  • Alt name
    lacZ
  • Species
    E. coli
  • Insert Size (bp)
    1681
  • GenBank ID
    MK533795.1 MK533795.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer GCTGGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CTCTACAAATGTGGTATGGCTGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAd5-Blue was a gift from Teresa De Los Santos (Addgene plasmid # 174431 ; http://n2t.net/addgene:174431 ; RRID:Addgene_174431)
  • For your References section:

    Adenovirus-vectored foot-and-mouth disease vaccine confers early and full protection against FMDV O1 Manisa in swine. Fernandez-Sainz I, Medina GN, Ramirez-Medina E, Koster MJ, Grubman MJ, de Los Santos T. Virology. 2017 Feb;502:123-132. doi: 10.1016/j.virol.2016.12.021. Epub 2016 Dec 28. 10.1016/j.virol.2016.12.021 PubMed 28039799
Commonly requested with: