pSelAct-Express
(Plasmid #174375)

• Purpose: (Empty Backbone) Plasmid for integrative expression, pUC19 backbone, Apr resistant casette, pCMP1::eGFP expression cassette, gateway compatible
• Depositing Lab: Gitta Coaker
• Publication: Stevens et al Mol Plant Microbe Interact. 2021 Dec;34(12):1336-1345. doi: 10.1094/MPMI-07-21-0171-TA. Epub 2021 Dec 10.

Backbone

• Vector backbone: pUC19
• Backbone size (bp): 6440
• Modifications to backbone: ApmR resistance cassette for integration, pCMP1::eGFP for expression, Gateway C1 cassette to clone in homologous regions
• Vector type: Expression vector for targeted integration
• Promoter: pCMP1

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GCATTAGGCACCCCAGGCTTTA
• 3′ sequencing primer: TGCAGACTGGCTGTGTATAAGG

Resource Information

• Supplemental Documents:
  • pSelAct-Express-with-Gateway.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For cloning in homology arms, can use Gateway, restriction ligation, or homology-based cloning such as Gibson/Infusion cloning. eGFP can be swapped for your gene of interest or can be fused (recommend homology base cloning).

Original pSelAct backbone was developed here:
Geize, R. van der, Jong, W. de, Hessels, G. I., Grommen, A. W. F., Jacobs, A. A. C., and Dijkhuizen, L. 2008. A novel method to generate unmarked gene deletions in the intracellular pathogen Rhodococcus equi using 5-fluorocytosine conditional lethality. Nucleic Acids Res. 36:e151

pSelAct-Express was develop and tested here:
Stevens, D. M., Tang, A., and Coaker, G. 2021. A Genetic Toolkit for Investigating Clavibacter Species: Markerless Deletion, Permissive Site Identification, and an Integrative Plasmid. Mol Plant-microbe Interactions. 34:1336–1345