pSelAct-KO
(Plasmid #174374)

• Purpose: (Empty Backbone) Plasmid for unmarked deletions, pUC19 backbone, Apr resistant casette, codA::app counterselection casette, gateway compatible
• Depositing Lab: Gitta Coaker
• Publication: Stevens et al Mol Plant Microbe Interact. 2021 Dec;34(12):1336-1345. doi: 10.1094/MPMI-07-21-0171-TA. Epub 2021 Dec 10.

Backbone

• Vector backbone: pUC19
• Backbone size (bp): 7373
• Modifications to backbone: ApmR resistance cassette for integration, codA:upp cassette for counterselection, Gateway C1 cassette to clone in flanking homologous regions
• Vector type: Vector for 2-step knockout by homologous recombination
• Promoter: N/A
• Selectable markers: codA:upp counterselection

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GCATTAGGCACCCCAGGCTTTA
• 3′ sequencing primer: TGCAGACTGGCTGTGTATAAGG

Resource Information

• Supplemental Documents:
  • pSelAct-KO.gb
• A portion of this plasmid was derived from a plasmid made by: Jeff Chang, Oregon State University

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Also known as pSelAct. For cloning in homology arms, can use Gateway, restriction-ligation, or homology-based cloning such as Gibson/Infusion cloning. Please cite at minimum paper 1) and a secondary paper that is most appropriate to your system of interest (2 or 3).

1. First development of pSelAct for knockouts in Rhodococcus equi:

Geize, R. van der, Jong, W. de, Hessels, G. I., Grommen, A. W. F., Jacobs, A. A. C., and Dijkhuizen, L. 2008. A novel method to generate unmarked gene deletions in the intracellular pathogen Rhodococcus equi using 5-fluorocytosine conditional lethality. Nucleic Acids Res. 36:e151

2. First development of pSelAct with Gateway cassette for knockouts in Rhodococcus fasicans:

Savory, E. A., Weisberg, A. J., Stevens, D. M., Creason, A. L., Fuller, S. L., Pearce, E. M., and Chang, J. H. 2020. Phytopathogenic Rhodococcus Have Diverse Plasmids With Few Conserved Virulence Functions. Front Microbiol. 11:1022

3. Later referred to as pSelAct-KO after optimization for knockouts in Clavibacter: 

Stevens, D. M., Tang, A., and Coaker, G. 2021. A Genetic Toolkit for Investigating Clavibacter Species: Markerless Deletion, Permissive Site Identification, and an Integrative Plasmid. Mol Plant-microbe Interactions. 34:1336–1345