pJEC581
(Plasmid #174369)

• Purpose: RFP reporter used to evaluate CRISPRa in bacteria, contains gRNA target sites every 10 bp upstream of the promoter.
• Depositing Lab: James Chappell
• Publication: Villegas Kcam et al Nucleic Acids Res. 2021 May 7;49(8):4793-4802. doi: 10.1093/nar/gkab211.

Backbone

• Vector backbone: SC101
• Backbone size w/o insert (bp): 3396
• Total vector size (bp): 4319
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: RFP with PAM rich sequence upstream promoter
• Alt name: Red Fluorescent Protein
• Species: Synthetic
• Insert Size (bp): 926
• Promoter: J23117

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acatcccggactacctgaa
• 3′ sequencing primer: ctttcagtttagcggtctgg

Resource Information

• Supplemental Documents:
  • MVK083.ape
• A portion of this plasmid was derived from a plasmid made by: Jesse Zalatan lab. pJF076Sa plasmid Addgene #113322

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry