pJEC626
(Plasmid #174367)

• Purpose: Activation domain for modular CRISPRa. AD-SYNZIP. Expresses alphaNTD from the E coli RNAP with a SYNZIP17 domain fused to the N terminus.
• Depositing Lab: James Chappell
• Publication: Villegas Kcam et al Nucleic Acids Res. 2021 May 7;49(8):4793-4802. doi: 10.1093/nar/gkab211.

Backbone

• Vector backbone: CloDF13
• Backbone size w/o insert (bp): 1925
• Total vector size (bp): 3250
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Alpha N-terminal domain from the E. coli RNA polymerase fused to SYNZIP17
• Alt name: RpoA
• Species: Synthetic; E. coli
• Insert Size (bp): 903
• Promoter: J23106

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acagggcaaaagattacgc
• 3′ sequencing primer: gtttattgactaccggaagcagtgtgac

Resource Information

• Supplemental Documents:
  • MVK155.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry