pJEC578
(Plasmid
#174366)
-
PurposedCas9 for modular CRISPRa. SYNZIP-dCas9. Expresses dCas9 with a SYNZIP18 domain fused to the N terminus.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 6184
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9 fused to SYNZIP18
-
Insert Size (bp)4222
- Promoter J23150
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gggatatatcaacggtggtatatccag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEC578 was a gift from James Chappell (Addgene plasmid # 174366 ; http://n2t.net/addgene:174366 ; RRID:Addgene_174366) -
For your References section:
Rational engineering of a modular bacterial CRISPR-Cas activation platform with expanded target range. Villegas Kcam MC, Tsong AJ, Chappell J. Nucleic Acids Res. 2021 May 7;49(8):4793-4802. doi: 10.1093/nar/gkab211. 10.1093/nar/gkab211 PubMed 33823546
