pMal-SLFN2
(Plasmid
#174322)
-
PurposeBacterial expression of MBP-tagged mouse SLFN2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174322 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMal
-
Backbone manufacturerNEB
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSLFN2
-
Alt nameShl
-
Alt nameShlf2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1137
-
Entrez GeneSlfn2 (a.k.a. Shlf2)
- Promoter tac promoter
-
Tag
/ Fusion Protein
- MBP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcorI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
- 3′ sequencing primer GCGGGCCTCTTCGCTATTAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMal-SLFN2 was a gift from Bruce Beutler (Addgene plasmid # 174322 ; http://n2t.net/addgene:174322 ; RRID:Addgene_174322) -
For your References section:
SLFN2 protection of tRNAs from stress-induced cleavage is essential for T cell-mediated immunity. Yue T, Zhan X, Zhang D, Jain R, Wang KW, Choi JH, Misawa T, Su L, Quan J, Hildebrand S, Xu D, Li X, Turer E, Sun L, Moresco EMY, Beutler B. Science. 2021 May 14;372(6543). pii: 372/6543/eaba4220. doi: 10.1126/science.aba4220. 10.1126/science.aba4220 PubMed 33986151