pCm N-term SMT3 NikJC199U
(Plasmid #174210)

• Purpose: Expression plasmid with a TEV removable C-term 8xHis Tag, an N-term SUMO tag and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.
• Depositing Lab: Brandon Greene
• Publication: Caceres et al Methods Enzymol. 2022;662:119-141. doi: 10.1016/bs.mie.2021.10.014. Epub 2021 Dec 7.

Backbone

• Vector backbone: pCm N-term-SMT3
• Backbone size w/o insert (bp): 3822
• Total vector size (bp): 5184
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
• Species: Streptomyces tendae
• Insert Size (bp): 1362
• Mutation: C199U
• GenBank ID: CAC80908.1
• Promoter: T7
• Tags / Fusion Proteins:
  • SMT3 (N terminal on backbone)
  • 8xHis (C terminal on backbone)
  • TEV (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gatataccatgagcactagtgactcagaagtcaatcaag
• 3′ sequencing primer: gtttccctgTGCCGGACGCAGGGC

Resource Information

• Supplemental Documents:
  • pCm N-term-SMT3-NikJC199U.gb
• A portion of this plasmid was derived from a plasmid made by: NikJ gene was a gift from Dr. Kenichi Yokoyama, Department of biochemistry, Duke University medical Center, Durham, north Carolina, USA. Department of Chemistry, Duke University, Durham, north Carolina, USA. *e-mail:

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry