Gene Trap - 24XMS2 Lentiviral Vector
(Plasmid #174198)

• Purpose: Lentiviral expression vector coding for Blasticidin, iRFP and 24X MS2 hairpins. All inserts are cloned in on the -strand to allow for splicing in when targeted into an intron of transcribed genes.
• Depositing Lab: Daniel Larson
• Publication: Wan et al Cell. 2021 May 27;184(11):2878-2895.e20. doi: 10.1016/j.cell.2021.04.012. Epub 2021 May 11.

Backbone

• Vector backbone: Lentivector
• Vector type: Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: iRFP
• Species: Synthetic
• Tags / Fusion Proteins:
  • Blasticidin
  • T2A
  • 24X MS2 hairpins

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: BsrGI (unknown if destroyed)
• 5′ sequencing primer: CATggcgcgcctagggccg
• 3′ sequencing primer: CCCGGGCCTCTCACTCTCTGA

Resource Information

• Supplemental Documents:
  • Gene Trap 24XMS2_LentiViral_Vector.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The inserts are cloned between NheI/BsrGI in reverse order on the -strand as follows:
NheI - 24XMS2 - FRT - BGH p(A) - Blasticidin - T2A - iRFP - Splice Acceptor - FRT - BsrGI.