-
PurposeLentiviral vector to constitutively express YAP under control of the EFS promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 7900
- Total vector size (bp) 9416
-
Modifications to backboneU6-shRNA sequence was removed and the original human PGK promoter was replaced with the EFS promoter. Puromycin resistance gene was replaced with an IRES-GFP-T2A-puroR sequence.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsRecommend TB over LB media.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYAP
-
Alt nameYAP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1584
- Promoter EFS
-
Tag
/ Fusion Protein
- 3x FLAG tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GAGAACCGTATATAAGTGCAGTAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJeff Wrana
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EFSp-GFP-YAP was a gift from Rod Bremner (Addgene plasmid # 174168 ; http://n2t.net/addgene:174168 ; RRID:Addgene_174168) -
For your References section:
Binary pan-cancer classes with distinct vulnerabilities defined by pro- or anti-cancer YAP/TEAD activity. Pearson JD, Huang K, Pacal M, McCurdy SR, Lu S, Aubry A, Yu T, Wadosky KM, Zhang L, Wang T, Gregorieff A, Ahmad M, Dimaras H, Langille E, Cole SPC, Monnier PP, Lok BH, Tsao MS, Akeno N, Schramek D, Wikenheiser-Brokamp KA, Knudsen ES, Witkiewicz AK, Wrana JL, Goodrich DW, Bremner R. Cancer Cell. 2021 Jul 13. pii: S1535-6108(21)00338-X. doi: 10.1016/j.ccell.2021.06.016. 10.1016/j.ccell.2021.06.016 PubMed 34270926