Skip to main content
Addgene

EFSp-GFP-YAP
(Plasmid #174168)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 174168 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 7900
  • Total vector size (bp) 9416
  • Modifications to backbone
    U6-shRNA sequence was removed and the original human PGK promoter was replaced with the EFS promoter. Puromycin resistance gene was replaced with an IRES-GFP-T2A-puroR sequence.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Recommend TB over LB media.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP
  • Alt name
    YAP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1584
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Promoter EFS
  • Tag / Fusion Protein
    • 3x FLAG tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GAGAACCGTATATAAGTGCAGTAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jeff Wrana
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EFSp-GFP-YAP was a gift from Rod Bremner (Addgene plasmid # 174168 ; http://n2t.net/addgene:174168 ; RRID:Addgene_174168)

  • For your References section:

    Binary pan-cancer classes with distinct vulnerabilities defined by pro- or anti-cancer YAP/TEAD activity. Pearson JD, Huang K, Pacal M, McCurdy SR, Lu S, Aubry A, Yu T, Wadosky KM, Zhang L, Wang T, Gregorieff A, Ahmad M, Dimaras H, Langille E, Cole SPC, Monnier PP, Lok BH, Tsao MS, Akeno N, Schramek D, Wikenheiser-Brokamp KA, Knudsen ES, Witkiewicz AK, Wrana JL, Goodrich DW, Bremner R. Cancer Cell. 2021 Jul 13. pii: S1535-6108(21)00338-X. doi: 10.1016/j.ccell.2021.06.016. 10.1016/j.ccell.2021.06.016 PubMed 34270926
Related items:
Commonly requested with: