TLCV2-sgHPDL #3
(Plasmid
#174165)
-
Purposeknock out HPDL in human cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTLCV2
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA against HPDL
-
gRNA/shRNA sequenceGACTCAGCCAGAACAAGAGT
-
SpeciesH. sapiens (human)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TLCV2-sgHPDL #3 was a gift from Michael Pacold (Addgene plasmid # 174165 ; http://n2t.net/addgene:174165 ; RRID:Addgene_174165) -
For your References section:
The polar oxy-metabolome reveals the 4-hydroxymandelate CoQ10 synthesis pathway. Banh RS, Kim ES, Spillier Q, Biancur DE, Yamamoto K, Sohn ASW, Shi G, Jones DR, Kimmelman AC, Pacold ME. Nature. 2021 Sep 1. pii: 10.1038/s41586-021-03865-w. doi: 10.1038/s41586-021-03865-w. 10.1038/s41586-021-03865-w PubMed 34471290