Skip to main content
Addgene

pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-503-WPRE
(Plasmid #174133)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174133 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5339
  • Total vector size (bp) 5670
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nos1ap
  • Alt name
    CAPON
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    331
  • Mutation
    Only contains the sequences coding for amino acids 396-427
  • GenBank ID
    NM_001109985
  • Entrez Gene
    Nos1ap (a.k.a. 6330408P19Rik, Capon)
  • Promoter hSyn
  • Tags / Fusion Proteins
    • mCherry (N terminal on backbone)
    • 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone was obtained from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976). mCherry was amplified by PCR from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976).
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-503-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 174133 ; http://n2t.net/addgene:174133 ; RRID:Addgene_174133)
  • For your References section:

    Hippocampal overexpression of NOS1AP promotes endophenotypes related to mental disorders. Freudenberg F, Candemir E, Chen X, Li LL, Esen-Sehir D, Schenk N, Kinoshita M, Grunewald L, Frerichs V, Fattakhov N, Manchen J, Bikas S, Kumar A, OLeary A, Slattery DA, von Engelhardt J, Courtney MJ, Reif A. EBioMedicine. 2021 Aug 26;71:103565. doi: 10.1016/j.ebiom.2021.103565. 10.1016/j.ebiom.2021.103565 PubMed 34455393