pAAV-EF1a-mitoGFP-DIO
(Plasmid #174112)

• Purpose: Cre-dependent expression of mitochondria-targeted Green Fluorescent Protein under control of the EF1a promoter
• Depositing Lab: Maarten Kole
• Publication: Kole et al Nat Commun. 2022 Dec 9;13(1):7598. doi: 10.1038/s41467-022-35350-x.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-EF1a-double floxed-mCherry-WPRE-HGHpA
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 5604
• Total vector size (bp): 6476
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mitoGFP
• Alt name: Cox8
• Species: H. sapiens (human)
• Insert Size (bp): 872
• Entrez Gene: COX8A (a.k.a. COX, COX8, COX8-2, COX8L, MC4DN15, VIII, VIII-L)
• Promoter: Ef1a
• Tags / Fusion Proteins:
  • Cox8 targeting sequence (N terminal on insert)
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GGATTGTAGCTGCTATTAGC
• 3′ sequencing primer: GGCAAATAACTTCGTATAGGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The mitoGFP gene was derived from plasmid #44385, deposited by the lab of Pantelis Tsoulfas

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2022.04.07.487496 for bioRxiv preprint.