Skip to main content
Addgene

pAAV-EF1a-mitoGFP-DIO
(Plasmid #174112)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174112 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV-EF1a-double floxed-mCherry-WPRE-HGHpA
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 5604
  • Total vector size (bp) 6476
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mitoGFP
  • Alt name
    Cox8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    872
  • Entrez Gene
    COX8A (a.k.a. COX, COX8, COX8-2, COX8L, MC4DN15, VIII, VIII-L)
  • Promoter Ef1a
  • Tags / Fusion Proteins
    • Cox8 targeting sequence (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GGATTGTAGCTGCTATTAGC
  • 3′ sequencing primer GGCAAATAACTTCGTATAGGA
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The mitoGFP gene was derived from plasmid #44385, deposited by the lab of Pantelis Tsoulfas

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.04.07.487496 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-mitoGFP-DIO was a gift from Maarten Kole (Addgene plasmid # 174112 ; http://n2t.net/addgene:174112 ; RRID:Addgene_174112)

  • For your References section:

    Parvalbumin basket cell myelination accumulates axonal mitochondria to internodes. Kole K, Voesenek BJB, Brinia ME, Petersen N, Kole MHP. Nat Commun. 2022 Dec 9;13(1):7598. doi: 10.1038/s41467-022-35350-x. 10.1038/s41467-022-35350-x PubMed 36494349
Related items:
Commonly requested with: