EGFP-Miro1v4
(Plasmid #174111)

• Purpose: Expresses the peroxisomal variant (splice variant 4) of Miro with an N-terminal EGFP.
• Depositing Lab: Pietro De Camilli
• Publication: Guillen-Samander et al J Cell Biol. 2021 May 3;220(5). pii: 212021. doi: 10.1083/jcb.202010004.

Backbone

• Vector backbone: pEGFP-C1
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 7000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Miro1 (var4, peroxisomal splice variant)
• Alt name: Miro1 var4
• Species: H. sapiens (human)
• Insert Size (bp): 2076
• GenBank ID: NM_001033568.3
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry