VPS13D^mScarlet
(Plasmid
#174110)
-
PurposeThe insert is a codon optimized DNA sequence encoding VPS13D with an internal mScarlet protein.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.4
-
Backbone manufacturerGenscript
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 20000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon optimized VPS13D
-
SpeciesH. sapiens (human)
-
Insert Size (bp)14112
-
MutationWith an internal mScarlet tag in aminoacid position 1576
- Promoter CMV
-
Tag
/ Fusion Protein
- mScarlet
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis was synthesized by Genscript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VPS13D^mScarlet was a gift from Pietro De Camilli (Addgene plasmid # 174110 ; http://n2t.net/addgene:174110 ; RRID:Addgene_174110) -
For your References section:
VPS13D bridges the ER to mitochondria and peroxisomes via Miro. Guillen-Samander A, Leonzino M, Hanna MG, Tang N, Shen H, De Camilli P. J Cell Biol. 2021 May 3;220(5). pii: 212021. doi: 10.1083/jcb.202010004. 10.1083/jcb.202010004 PubMed 33891013