VPS13D^Halo
(Plasmid #174108)

• Purpose: The insert is a codon optimized DNA sequence encoding VPS13D with an internal Halo tag.
• Depositing Lab: Pietro De Camilli
• Publication: Guillen-Samander et al J Cell Biol. 2021 May 3;220(5). pii: 212021. doi: 10.1083/jcb.202010004.

Backbone

• Vector backbone: pcDNA3.4
• Backbone manufacturer: Genscript
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 20000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Codon optimized VPS13D
• Species: H. sapiens (human)
• Insert Size (bp): 14112
• Mutation: With an internal Halo tag in aminoacid position 1576
• Promoter: CMV
• Tag / Fusion Protein:
  • Halo

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • VPS13D^Halo_pcDNA3.4
• A portion of this plasmid was derived from a plasmid made by: This was synthesized by Genscript.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry