pLVX-SRRM2-mCherry
(Plasmid #174089)

• Purpose: Inducibly expresses SRRM2-mCherry in mammalian cells with the Tet-on system
• Depositing Labs: Wesley Sundquist, Katie Ullman
• Publication: Williams et al Elife. 2021 Aug 4;10. pii: 63743. doi: 10.7554/eLife.63743.

Backbone

• Vector backbone: pLVX
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 7756
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SRRM2
• Alt name: Serine/Arginine Repetitive Matrix 2
• Alt name: Tax-Responsive Enhancer Element-Binding Protein 803
• Alt name: Splicing Coactivator Subunit SRm300
• Species: H. sapiens (human)
• Insert Size (bp): 8253
• GenBank ID: 23524
• Entrez Gene: SRRM2 (a.k.a. 300-KD, CWF21, Cwc21, HSPC075, MRD72, SRL300, SRm300)
• Promoter: TREtight
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtcgaggtaggcgtgtacgg
• 3′ sequencing primer: gaggccagaggccacttgtgtag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Lukas Pelkmans and Arpan Rai, University of Zurich

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry