Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLVX-SRRM2-mCherry
(Plasmid #174089)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174089 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLVX
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 7756
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SRRM2
  • Alt name
    Serine/Arginine Repetitive Matrix 2
  • Alt name
    Tax-Responsive Enhancer Element-Binding Protein 803
  • Alt name
    Splicing Coactivator Subunit SRm300
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    8253
  • GenBank ID
    23524
  • Promoter TREtight
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtcgaggtaggcgtgtacgg
  • 3′ sequencing primer gaggccagaggccacttgtgtag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Lukas Pelkmans and Arpan Rai, University of Zurich

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-SRRM2-mCherry was a gift from Wesley Sundquist & Katie Ullman (Addgene plasmid # 174089 ; http://n2t.net/addgene:174089 ; RRID:Addgene_174089)
  • For your References section:

    Identification of abscission checkpoint bodies as structures that regulate ESCRT factors to control abscission timing. Williams LK, Mackay DR, Whitney MA, Couldwell GC, Sundquist WI, Ullman KS. Elife. 2021 Aug 4;10. pii: 63743. doi: 10.7554/eLife.63743. 10.7554/eLife.63743 PubMed 34346309