pLVX-CLK1
(Plasmid #174088)

• Purpose: Inducibly expresses Myc-CLK1 in mammalian cells with the Tet-on system
• Depositing Labs: Wesley Sundquist, Katie Ullman
• Publication: Williams et al Elife. 2021 Aug 4;10. pii: 63743. doi: 10.7554/eLife.63743.

Backbone

• Vector backbone: pLVX
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 7756
• Total vector size (bp): 9269
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CLK1
• Alt name: Dual Specificity Protein Kinase CLK1
• Alt name: CDC Like Kinase 1
• Alt name: Protein Tyrosine Kinase STY
• Species: H. sapiens (human)
• Insert Size (bp): 1452
• GenBank ID: 1195
• Entrez Gene: CLK1 (a.k.a. CLK, CLK/STY, STY)
• Promoter: TREtight
• Tag / Fusion Protein:
  • Myc-GSSS (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtcgaggtaggcgtgtacgg
• 3′ sequencing primer: gaggccagaggccacttgtgtag

Resource Information

• Supplemental Documents:
  • pLVX CLK.gbk
• A portion of this plasmid was derived from a plasmid made by: DNASU: HsCD00038192

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry