pMH0004
(Plasmid
#174087)
-
PurposeUCOE-SFFV-Cas9-BFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174087 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
- Total vector size (bp) 14525
-
Vector typeLentiviral
-
Selectable markersBFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas9-BFP
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgggaagcaatagcatgatac
- 3′ sequencing primer agtgcaggggaaagaatagtagac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See bioRxiv article for preprint info - https://www.biorxiv.org/content/10.1101/775080v2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH0004 was a gift from Jonathan Weissman (Addgene plasmid # 174087 ; http://n2t.net/addgene:174087 ; RRID:Addgene_174087) -
For your References section:
Functional single-cell genomics of human cytomegalovirus infection. Hein MY, Weissman JS. Nat Biotechnol. 2022 Mar;40(3):391-401. doi: 10.1038/s41587-021-01059-3. Epub 2021 Oct 25. 10.1038/s41587-021-01059-3 PubMed 34697476