pDule2-3-nitroTyrosine (A7)
(Plasmid #174079)

• Purpose: Plasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the third generation Mj 3NY (A7) synthetase and cognate amber suppressing tRNA in Ecoli.
• Depositing Lab: Ryan Mehl
• Publication: Beyer et al J Mol Biol. 2020 Jul 24;432(16):4690-4704. doi: 10.1016/j.jmb.2020.06.014. Epub 2020 Jun 19.

Backbone

• Vector backbone: pDule2
• Backbone size w/o insert (bp): 6082
• Total vector size (bp): 7003
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
• Alt name: 3NY (A7) synthetase
• Alt name: 3-nitroY (A7) synthetase
• Alt name: 3-nitroTyr (A7) synthetase
• Species: Methanocaldococcus jannaschii
• Insert Size (bp): 921
• Mutation: Y32H H70T D158H I159A L162R
• Promoter: GlnRS (constitutive)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGTCACTGCGTCTTTTACTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry