Addgene: pDule-3-nitroTyrosine (A7) Skip to main content
Addgene

pDule-3-nitroTyrosine (A7)
(Plasmid #174078)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174078 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDule
  • Backbone size w/o insert (bp) 5412
  • Total vector size (bp) 6333
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
  • Alt name
    3NY (A7) synthetase
  • Alt name
    3-nitroY (A7) synthetase
  • Alt name
    3-nitroTyr (A7) synthetase
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Y32H H70T D158H I159A L162R
  • Promoter GlnRS (constitutive)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule-3-nitroTyrosine (A7) was a gift from Ryan Mehl (Addgene plasmid # 174078 ; http://n2t.net/addgene:174078 ; RRID:Addgene_174078)
  • For your References section:

    Overcoming Near-Cognate Suppression in a Release Factor 1-Deficient Host with an Improved Nitro-Tyrosine tRNA Synthetase. Beyer JN, Hosseinzadeh P, Gottfried-Lee I, Van Fossen EM, Zhu P, Bednar RM, Karplus PA, Mehl RA, Cooley RB. J Mol Biol. 2020 Jul 24;432(16):4690-4704. doi: 10.1016/j.jmb.2020.06.014. Epub 2020 Jun 19. 10.1016/j.jmb.2020.06.014 PubMed 32569745